"molecular marker" 검색결과 201-220 / 277건

• 

  PCR 가이드

  The hig probes/primer Taqman®, molecular beacons Increases specificity of sample detection Opportunities ... 전기영동으로 쉽게 감지 가능 RFLP의 응용 유전병관련 marker로 활용 : RFLP가 유전병관련 유전자 좌위에 접근하면, 돌연변이 유전자를 추적하는데 사용가능 예시 gcatatgttccacttgcttaattttactcttcttcatgctcagcaatttgtccctgctca

  리포트 | 30페이지 | 1,000원 | 등록일 2010.06.28 | 수정일 2018.01.02

  다운로드 장바구니
• 

  Hill reaction

  Effect of Abiotic stresses on photosynthesis Choi soo-bin, Kim jin-a, Kim sung-gun Department of Molecular ... We label-7 tubes(1-7) with a marker pan and prepare each tube with the proper amount(ml) of chloroplast

  리포트 | 10페이지 | 2,000원 | 등록일 2010.08.25

  다운로드 장바구니
• 

  Virus RNA isolation

  Marker도 0.24kb정도에 뚜렷하게 나타나있다. 7조는 완전히 퍼지면서 빠져버린 것 같다. Band를 확인 할 수 없는 상태이다. ... /BS636_molecular_virology/ Chapter%206.doc - www.sclab.co.kr/lab_infor/gmo.html ... db=Q - http://biochemistry.yonsei.ac.kr/biochem_molecular/gene_cloning_20.php - bio.kaist.ac.kr/~movi

  리포트 | 5페이지 | 1,500원 | 등록일 2007.06.18

  다운로드 장바구니
• 

  김치에서 Tetracycline 내성 유산균의 분리

  Lanes: 1, plasmid DNA of molecular weight size marker; 2, lambda HindIII size marker; 3, uncut plasmid

  리포트 | 24페이지 | 2,000원 | 등록일 2009.08.12

  다운로드 장바구니
• 

  [전기영동] SDS-PAGE (단백질 분자량 측정)

  또한 입자는 그 주위에 ion 분위기를 만들면서 움직이지만 조금 전에 만들어진 ion 분위기는 즉시 소멸되지 않기 때문에 또한 입자의 영동속도가 낮아진다. ③ 분자체질의 효과(molecular ... [그림 5] 전기영동중의 단백조 [그림 7] Marker와 단백질의 분자량과 이동도 Ⅱ. 실험 재료, 시약 및 기구 Z. ... 단백질의 이동도8 [그림 7] Marker와 단백질의 분자량과 이동도8 [그림 8] 전기영동 결과 사진12 [그림 9] 결과로 본 단백질 분자량에 따른 이동 거리12 ??

  리포트 | 13페이지 | 3,200원 | 등록일 2008.10.31 | 수정일 2021.04.12

  다운로드 장바구니
• 

  먹이섭취량, 지방생성과 성장의 돼지형질과 관 련된 후보유전자 Melanocortin – 4 Receptor(MC4-R)

  Molecular marker (M) and MC4R genotypes are indicated at the top of each lane (Kwan Suk Kim et al. 2000 ... Rothschild M.F. 2001 A molecular genome scan analysis to identify chromosomal regions influencing economic

  리포트 | 14페이지 | 1,500원 | 등록일 2008.11.27

  다운로드 장바구니
• 

  Restriction Enzyme Digestion and Gel Electrophoresis( Plasmid DNA를 restriction enzyme으로 자른 후 DNA size marker와 비교하는 실험)

  recombinant DNA technology에는 잘 이용되지 않지만, type Ⅱ는 특정 sequence를 인식하고 그것의 phosphodiester bond를 자르기 때문에 molecular ... 목적 ☞ Plasmid DNA를 restriction enzyme으로 자른 후 DNA size marker와 비교하여 본다. 5. ... (digested DNA, uncut plasmid, size marker → 순서대로 loading 할 것) ⅲ.

  리포트 | 8페이지 | 1,500원 | 등록일 2008.04.15

  다운로드 장바구니
• 

  항체제조 및 Western blotting

  우측 상용 GFP, induction 전후, his tag, marker에 상용 his 항체 처리. ... 한 손으로 mouse를 잡고 70% et용 GFP, induction 전후, his tag, marker에 immune 혈청 처리. ... 전기영동은 하전된 단백질의 전장(electric field) 내에서의 이동에 기인한 방법으로 전기영동에 의해서 단백질의 등전점(isoelectric point)과 대략적 분자량(molecular

  리포트 | 8페이지 | 1,500원 | 등록일 2009.06.30

  다운로드 장바구니
• 

  대장균(E.coli)에서의 Plasmid 추출 실험레포트

  -결과 좌측부터 lane 별로 순번을 붙이면 내 실험결과는 3번 lane이다. 1번 lane은 Marker로 100bp를 사용하였다. ... Reference 참고 사이트 http://biochemistry.yonsei.ac.kr/biochem_molecular/gene_cloning_20.php http://kin.naver.com ... 크게 두 개의 band가 보이는데 Marker를 따라 읽으면 위에 얇은 band는 5Kb 밑에 상대적으로 두꺼운 band는 2Kb에 위치에 존재한다.

  리포트 | 3페이지 | 1,000원 | 등록일 2008.05.05

  다운로드 장바구니
• 

  [생물학]【A+】생물공학- 진단키트

  간편화 및 자동화로 진단범위의 확대 IT 기업 등의 적극적 투자 개발 진입 시장 현황 세계 진단키트 시장 규모 참고자료 : Trimark publications ’cardiac marker ... 장시간의 검사시간 빈혈진단 방사성 동위원소의 유해 FIA( 형광면역분석 ) 모든 질병검사 정확 , 신속 비특이적 반응이 존재 자동화가 용이 간단한 표지물질 분자생물학적 진단키트 (Molecular

  리포트 | 25페이지 | 1,000원 | 등록일 2011.06.19

  다운로드 장바구니
• 

  [자연과학](예비실험보고서) SDS PAGE

  It is common to run "marker proteng the distance traveled relative to the marker. ... Thus proteins may be separated roughly according to size (and therefore, molecular weight). ... Without SDS, different proteins with similar molecular weights would migrate differently due to differences

  리포트 | 2페이지 | 1,000원 | 등록일 2007.07.02

  다운로드 장바구니
• 

  SDS-Polyacrylamide Gel Electrophoreses (PAGE)

  Relative Mobility (Rm) : 0 - 1 Rm = Distance of Protein migration / Distance of Dye migration Marker ... Stacking gel 은 large-pore gel이므로 단백질의 molecular sieving현상은 나타나지 않는다. ... 이론 SDS-polyacrylamide gel electrophoresis(SDS-PAGE)는 단백질 정제과정동안 샘플들의 순도의 분석뿐만 아니라 단백질의 molecular weight를

  리포트 | 5페이지 | 1,000원 | 등록일 2008.06.16

  다운로드 장바구니
• 

  [생명공학]Conclusion, Expressoin, Purification, Refold

  Lane M, protein molecular weight marker; Lane 1, dissolved inclusion body protein before chromatography ... Lane M, protein molecular weight marker; Lane 1 and 2, total extract of E.coli cells harbouring pPROEXTM ... ; Lane 2, purified scfv protein. ♣ 다른 부위에서만 관찰되던 protein들이 사라지고, 올바른 molecular weigh를 보이는 것으로 보아 깨끗하게

  리포트 | 17페이지 | 1,000원 | 등록일 2006.05.19

  다운로드 장바구니
• 

  Insertion/Deletion Polymorphism of Angiotensin converting enzyme 1 (ACE1)

  가장 왼쪽 well에 100bp ladder DNA size marker 1μㅣ를 loading하고 100V에서 20분 가량 전기영동한다. ... Reference 1. 2006, 실험생화학, Korean society of medical biology and molecular biology, 5th edition 2.

  리포트 | 4페이지 | 3,000원 | 등록일 2010.08.08 | 수정일 2023.10.23

  다운로드 장바구니
• 

  SDS-PAGE 전기영동법

  제일 왼쪽 레인에는 단백질의 분자량을 알고 있는 시료를 넣어 분자량의 marker로 사용하고, 겔을 보존하기 위해서 아래와 같이 사진을 찍어두었다. ... 끌림 현상은 핵산 등 high charge, high molecular mass를 갖는 물질들에 의해 일어날 수 있다. ... running gel에 이르게 되면 running gel의 높은 pH는 glycine이온을 음전하로 강하게 대전시켜 glycine의 이동속도가 단백질보다 빠르게 되며 단백질은 gel내에서 molecular

  리포트 | 6페이지 | 1,000원 | 등록일 2009.02.18

  다운로드 장바구니
• 

  Preparation and Concentration Determination of Plasmid DNA from E. coli -Mini- Scale Preparation(E.c

  plasmid DNA를 anion-exchange resin에 결합시킨 후 medium salt buffer로 resin을 washing해 RNA, protein, dyes, 그리고 low-molecular ... 분자생물학에서 cloning vector로 사용되는 plasmid는 replication origin, selectable marker, (multi) cloning site의 3가지 ... Replication origin는 DNA 복제가 시작되는 부위이고, selectable marker는 대개 항생물질에 대한 내성을 나타내는 유전자를 encode하는 부분이며, plasmid가

  리포트 | 5페이지 | 1,000원 | 등록일 2008.04.15

  다운로드 장바구니
• 

  임신성 고혈압 (gestational hypertension)

  Circulating factors as markers and mediators of endothelial cell dysfunction in preeclampsia. ... Characterization at the molecular, cellular and in vivo level. FEBS 1991;285:199-212. 31. Stark JM.

  리포트 | 26페이지 | 3,000원 | 등록일 2009.06.08

  다운로드 장바구니
• 

  [생물학 및 실험] 형질전환

  이 DNA는 세포로 들어가고 복제되고 selection marker가 발현된다. ... http://www.kordic.re.kr/%7Etrend/Content302/biology19.html 4. http://biochemistry.yonsei.ac.kr/biochem_molecular

  리포트 | 5페이지 | 2,000원 | 등록일 2010.03.21

  다운로드 장바구니
• 

  Protein extraction(E.coli), Coomassie stainig

  그래서 83~175kDa marker 사이에 각 조의 밴드가 굵게 형성됨을 관찰할 수 있다. 5. ... 사진에 marker 바로 옆에 조교님이 하신 c 아래 1 2 라는 글씨 때문에 어떤 것이 실험군이고, 대조군인지 혼동이 되었다. ... 다양한 pore size는 molecular sieve의 기능을 가져 입자의 분리에 좋으며 plastic gel이므로 투명하고, 화학적 작용이 없으며, 전기적으로 중성이므로 전기삼투현상이

  리포트 | 4페이지 | 1,500원 | 등록일 2008.09.20 | 수정일 2020.08.29

  다운로드 장바구니
• 

  Kaposi’s Sarcoma

  Subsequently, HHV-8 initiate와 KS cell growth, proliferation 유지가 어떻게 되는지 여러 molecular mechanism 들이 밝혀졌다 ... for blood endothelial cells, but express markers for smooth muscle cells, macrophages, dendritic cells ... vimentin+, collagen type 4+/-, laminin+/-, vWF+/-) endothelial origin 그러나, KS cells가 PAL-E(specific marker

  리포트 | 14페이지 | 1,000원 | 등록일 2007.07.10

  다운로드 장바구니